Быстрый заказ

Text Size:AAA

Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL17A Информация о продукте «Клон cDNA»
Размер кДНК:477bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 17A with N terminal HA tag.
Синоним гена:Il17, IL-17, CTLA-8, IL-17A
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80461-ACGRBS15400
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80461-ACRRBS15400
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80461-CFRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80461-CHRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80461-CMRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80461-CYRBS13340
Крыса IL17A/IL-17A/IL17 Джин клон кДНК в вектор клонированияRG80461-GRBS5130
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80461-NFRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80461-NHRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80461-NMRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80461-NYRBS13340
Крыса IL17A/IL-17A/IL17 Джин ORF экспрессии кДНК клона плазмидыRG80461-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Каталог: RG80461-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.