After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL13 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053828.1
Размер кДНК:396bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 13 with N terminal HA tag.
Синоним гена:IL13
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80460-ACGRBS15400
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80460-ACRRBS15400
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80460-CFRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80460-CHRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80460-CMRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80460-CYRBS13340
Крыса IL13/IL-13/ALRH Джин клон кДНК в вектор клонированияRG80460-GRBS5130
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80460-NFRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80460-NHRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80460-NMRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80460-NYRBS13340
Крыса IL13/IL-13/ALRH Джин ORF экспрессии кДНК клона плазмидыRG80460-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.

Ссылки
  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • Size / Price
    Каталог: RG80460-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».