Быстрый заказ

Text Size:AAA

Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL12RB2 Информация о продукте «Клон cDNA»
Размер кДНК:2610bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 12 receptor, beta 2 with N terminal Flag tag.
Синоним гена:Il12rb2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80185-ACGRBS22240
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80185-ACRRBS22240
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80185-CFRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80185-CHRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80185-CMRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80185-CYRBS20190
Крыса IL12RB2 Джин клон кДНК в вектор клонированияRG80185-GRBS5130
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80185-NFRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80185-NHRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80185-NMRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80185-NYRBS20190
Крыса IL12RB2 Джин ORF экспрессии кДНК клона плазмидыRG80185-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin-12 receptor subunit beta-2 (IL12RB2), also known as IL-12 receptor subunit beta-2, IL-12R subunit beta-2, IL-12R-beta-2, and IL-12RB2, is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. IL12RB2 belongs to the type I cytokine receptor family. The coexpression of IL12RB2 and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of IL12RB2 is up-regulated by IFN gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of IL12RB2 is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. This subunit is the signaling component coupling to the JAK2/STAT4 pathway. IL12RB2 promotes the proliferation of T-cells as well as NK cells. IL12RB2 induces the promotion of T-cells towards the Th1 phenotype by strongly enhancing IFN-gamma production.

  • Yamamoto K, et al. (1997) Assignment of IL12RB1 and IL12RB2, interleukin-12 receptor beta 1 and beta 2 chains, to human chromosome 19 band p13.1 and chromosome 1 band p31.2, respectively, by in situ hybridization. Cytogenet. 77 (3-4): 257-8.
  • Morton SM, et al. (1998) Assignment of IL12RB2 to human chromosome 1p31.3→p31.2 between D1S230 and D1S198. Cytogenet. Cell Genet. 79 (3-4): 282-3.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci USA. 99 (26): 16899-903.
  • Size / Price
    Каталог: RG80185-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.