After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL11 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133519.3
Размер кДНК:600bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 11 with N terminal Flag tag.
Синоним гена:Il11
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80169-ACGRBS15400
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80169-ACRRBS15400
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80169-CFRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80169-CHRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80169-CMRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80169-CYRBS13340
Крыса IL-11 / interleukin 11 Джин клон кДНК в вектор клонированияRG80169-GRBS5130
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80169-NFRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80169-NHRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80169-NMRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80169-NYRBS13340
Крыса IL-11 / interleukin 11 Джин ORF экспрессии кДНК клона плазмидыRG80169-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IL11 is a multifunctional cytokine first isolated in 1990 from bone marrow-derived stromal cells. It is a key regulator of multiple events in hematopoiesis, most notably the stimulation of megakaryocyte maturation. IL11 is also known under the names adipogenesis inhibitory factor (AGIF) and oprelvekin. IL11 can improve platelet recovery after chemotherapy-induced thrombocytopenia, induce acute phase proteins, modulate antigen-antibody responses, participate in the regulation of bone cell proliferation and differentiation and could be use as a therapeutic for osteoporosis. IL11 stimulates the growth of certain lymphocytes and, in the murine model, stimulates an increase in the cortical thickness and strength of long bones. As a signaling molecule, IL11 has a variety of functions associated with its receptor interleukin 11 receptor alpha; such functions include placentation and to some extent of decidualization.

Ссылки
  • McKinley D. et al., 1992, Genomics. 13 (3): 814-9.
  • Paul SR. et al., 1990, Proc Natl Acad Sci. 87 (19): 7512-6.
  • Kawashima I. et al., 1991, FEBS Lett. 283 (2): 199-202.
  • Size / Price
    Каталог: RG80169-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».