Быстрый заказ

Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL10RA Информация о продукте «Клон cDNA»
Размер кДНК:1710bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 10 receptor, alpha with N terminal Flag tag.
Синоним гена:Il10ra, IL-10ra
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80183-ACGRBS16760
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80183-ACRRBS16760
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80183-CFRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80183-CHRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80183-CMRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80183-CYRBS14710
Крыса CD219 / IL10RA Джин клон кДНК в вектор клонированияRG80183-GRBS5130
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80183-NFRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80183-NHRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80183-NMRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80183-NYRBS14710
Крыса CD219 / IL10RA Джин ORF экспрессии кДНК клона плазмидыRG80183-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD219, also known as IL10RA, is a receptor for interleukin 10. CD219 has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD219 promotes survival of progenitor myeloid cells. Activation of CD219 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.

  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
  • Size / Price
    Каталог: RG80183-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.