Быстрый заказ

Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IL10RB Информация о продукте «Клон cDNA»
Размер кДНК:1056bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interleukin 10 receptor, beta with N terminal Flag tag.
Синоним гена:RGD1560373, Il10rb
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80184-ACGRBS15400
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80184-ACRRBS15400
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80184-CFRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80184-CHRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80184-CMRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80184-CYRBS13340
Крыса IL10RB / IL-10RB Джин клон кДНК в вектор клонированияRG80184-GRBS5130
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80184-NFRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80184-NHRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80184-NMRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80184-NYRBS13340
Крыса IL10RB / IL-10RB Джин ORF экспрессии кДНК клона плазмидыRG80184-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
  • Size / Price
    Каталог: RG80184-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.