Быстрый заказ

Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса IFNGR1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_053783.1
    Размер кДНК:1395bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon gamma receptor 1 with C terminal His tag.
    Синоним гена:Ifngr, Ifngr1
    Виды:Rat
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IFNGR1 qPCR primers for gene expression analysis, RP300299 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80328-ACGRBS15400
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80328-ACRRBS15400
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80328-CFRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80328-CHRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80328-CMRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80328-CYRBS13340
    Крыса IFNGR1/CD119 Джин клон кДНК в вектор клонированияRG80328-GRBS5130
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80328-NFRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80328-NHRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80328-NMRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80328-NYRBS13340
    Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмидыRG80328-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.

    Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7
  • Size / Price
    Каталог: RG80328-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».