Быстрый заказ

Text Size:AAA

Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFNGR1 Информация о продукте «Клон cDNA»
Размер кДНК:1395bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon gamma receptor 1 with C terminal HA tag.
Синоним гена:Ifngr, Ifngr1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80328-ACGRBS15400
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80328-ACRRBS15400
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80328-CFRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80328-CHRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80328-CMRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80328-CYRBS13340
Крыса IFNGR1/CD119 Джин клон кДНК в вектор клонированияRG80328-GRBS5130
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80328-NFRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80328-NHRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80328-NMRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80328-NYRBS13340
Крыса IFNGR1/CD119 Джин ORF экспрессии кДНК клона плазмидыRG80328-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD119 (cluster of differentiation 119), also known as IFNGR1 ( interferon gamma receptor 1), is part of the heterodimeric gamma interferon receptor which consists of IFNGR1 (CD119) and IFNGR2. The IFNGR1 gene encodes the ligand-binding chain (alpha) of the interteron receptor while IFNGR gene encodes the non-ligand binding partner. The ability of the interferon-γ was achieved through binding to the interferon receptor CD119. After binding, the products of activated T-lymphocytes interferon-γ exerts antiviral activity, growth inhibitory effect, and several immune- regulatory activities on a variety of cell types.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Novick D, et al. (1987) The human interferon-gamma receptor. The journal of biological chemistry. 262 (18): 8483-7
  • Size / Price
    Каталог: RG80328-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.