Быстрый заказ

Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFNG Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_138880.2
Размер кДНК:471bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ?interferon gamma.
Синоним гена:IFNG2, Ifng
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80234-ACGRBS15400
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80234-ACRRBS15400
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80234-CFRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80234-CHRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80234-CMRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80234-CYRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин клон кДНК в вектор клонированияRG80234-GRBS5130
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80234-NFRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80234-NHRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80234-NMRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80234-NYRBS13340
Крыса Interferon Gamma/IFN gamma/IFNG Джин ORF экспрессии кДНК клона плазмидыRG80234-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Ссылки
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Каталог: RG80234-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».