Быстрый заказ

Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFNB1 Информация о продукте «Клон cDNA»
Размер кДНК:555bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon beta 1, fibroblast with N terminal Flag tag.
Синоним гена:Ifnb, Ifnb1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80172-ACGRBS15400
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80172-ACRRBS15400
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80172-CFRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80172-CHRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80172-CMRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80172-CYRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин клон кДНК в вектор клонированияRG80172-GRBS5130
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80172-NFRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80172-NHRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80172-NMRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80172-NYRBS13340
Крыса Interferon beta/IFN-beta/IFNB1 Джин ORF экспрессии кДНК клона плазмидыRG80172-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interferons (IFNs) are natural glycoproteins belonging to the cytokine superfamily, and are produced by the cells of the immune system of most vertebrates in response to challenges by foreign agents such as viruses, parasites and tumor cells. Interferon-beta (IFN beta) is an extra-cellular protein mediator of host defense and homeostasis. IFN beta has well-established direct antiviral, antiproliferative and immunomodulatory properties. Recombinant IFN beta is approved for the treatment of relapsing-remitting multiple sclerosis. The recombinant IFN beta protein has the theoretical potential to either treat or cause autoimmune neuromuscular disorders by altering the complicated and delicate balances within the immune system networks. It is the most widely prescribed disease-modifying therapy for multiple sclerosis (MS). Large-scale clinical trials have established the clinical efficacy of IFN beta in reducing relapses and slowing disease progression in relapsing-remitting MS. IFN beta therapy was shown to be comparably beneficial for opticospinal MS (OSMS) and conventional MS in Japanese. IFN beta is effective in reducing relapses in secondary progressive MS and may have a modest effect in slowing disability progression. In addition to the common antiviral activity, IFN beta also induces increased production of the p53 gene product which promotes apoptosis, and thus has therapeutic effect against certain cancers. The role of IFN-beta in bone metabolism could warrant its systematic evaluation as a potential adjunct to therapeutic regimens of osteolytic diseases. Furthermore, IFN beta might play a beneficial role in the development of a chronic progressive CNS inflammation.

  • Kohriyama T, et al. (2008) Interferon-beta treatment for multiple sclerosis and predictors of response. Nippon Rinsho. 66(6): 1119-26.
  • Stbgen JP. (2009) Recombinant interferon-beta therapy and neuromuscular disorders. J Neuroimmunol. 212(1-2): 132-41.
  • Abraham AK, et al. (2009) Mechanisms of interferon-beta effects on bone homeostasis. Biochem Pharmacol. 77(12): 1757-62.
  • Size / Price
    Каталог: RG80172-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.