Быстрый заказ

Text Size:AAA

Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFNAR1 Информация о продукте «Клон cDNA»
Размер кДНК:1320bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon (alpha, beta and omega) receptor 1 with N terminal Flag tag.
Синоним гена:Ifnar1, Ifnar1_predicted
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80180-ACGRBS15400
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80180-ACRRBS15400
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80180-CFRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80180-CHRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80180-CMRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80180-CYRBS13340
Крыса IFNAR1 Джин клон кДНК в вектор клонированияRG80180-GRBS5130
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80180-NFRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80180-NHRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80180-NMRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80180-NYRBS13340
Крыса IFNAR1 Джин ORF экспрессии кДНК клона плазмидыRG80180-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Interferon-alpha/beta receptor alpha chain (IFNAR1) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. The encoded protein also functions as an antiviral factor. Tyk2 slows down IFNAR1 degradation and that this is due, at least in part, to inhibition of IFNAR1 endocytosis. Mutant versions of IFNAR1, in which Tyr466 is changed to phenylalanine, can act in a dominant negative manner to inhibit phosphorylation of STAT2. These observations are consistent with a model in which IFNAR1 mediates the interaction between JAK kinases and the STAT transcription factors.

  • Yan H, et al. (1996) Phosphorylated interferon-alpha receptor 1 subunit (IFNaR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J. 15(5): 1064-74.
  • Richter MF, et al. (1998) Specific contribution of Tyk2 JH regions to the binding and the expression of the interferon alpha/beta receptor component IFNAR1. J Biol Chem. 273(38): 24723-9.
  • Abramovich C, et al. (1997) A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J. 16(2): 260-6.
  • Size / Price
    Каталог: RG80180-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.