After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFNA1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001014786.1
Размер кДНК:579bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon-alpha 1 with N terminal Flag tag.
Синоним гена:IFN-alpha1, Ifna1
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80174-ACGRBS15400
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80174-ACRRBS15400
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80174-CFRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80174-CHRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80174-CMRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80174-CYRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин клон кДНК в вектор клонированияRG80174-GRBS5130
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80174-NFRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80174-NHRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80174-NMRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80174-NYRBS13340
Крыса IFN-alpha / IFNA1 / IFN Джин ORF экспрессии кДНК клона плазмидыRG80174-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

Ссылки
  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Каталог: RG80174-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».