After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat IFITM3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001136124.1
Размер кДНК:414bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus interferon induced transmembrane protein 3 with N terminal Myc tag.
Синоним гена:rat8, DSPA2b
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80739-ACGRBS15400
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80739-ACRRBS15400
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80739-CFRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80739-CHRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80739-CMRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80739-CYRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80739-NFRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80739-NHRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80739-NMRBS13340
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80739-NYRBS13340
Крыса IFITM3 Джин клон кДНК в вектор клонированияRG80739-URBS5130
Крыса IFITM3 Джин ORF экспрессии кДНК клона плазмидыRG80739-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.

Ссылки
  • Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.
  • Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.
  • Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.
  • Size / Price
    Каталог: RG80739-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».