After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ICAM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001007725.1
Размер кДНК:834bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus intercellular adhesion molecule 2.
Синоним гена:MGC95023, Icam2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80239-ACGRBS15400
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80239-ACRRBS15400
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80239-CFRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80239-CHRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80239-CMRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80239-CYRBS13340
Крыса ICAM-2/CD102 Джин клон кДНК в вектор клонированияRG80239-GRBS5130
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80239-NFRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80239-NHRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80239-NMRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80239-NYRBS13340
Крыса ICAM-2/CD102 Джин ORF экспрессии кДНК клона плазмидыRG80239-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

Ссылки
  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • Size / Price
    Каталог: RG80239-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».