After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Rat HepaCAM2 natural ORF mammalian expression plasmid

ПаспортОбзорыСвязанные продуктыПротоколы
Rat HEPACAM2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106580.2
Размер кДНК:1392bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus HEPACAM family member 2.
Синоним гена:RGD1305697, Hepacam2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Фон

HepaCAM2 belongs to the immunoglobulin family. HepaCAM2, together with HEPACAM1, are cell adhesion molecules. HEPACAM1 modulates cell adhesion and migration. It also inhibits cancer cell growth. HepaCAM2 contains 2 Ig-like C2-type (immunoglobulin-like) domains. The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions.

Ссылки
  • Moh MC, et al. (2008) Expression of hepaCAM is downregulated in cancers and induces senescence-like growth arrest via a p53/p21-dependent pathway in human breast cancer cells. Carcinogenesis. 29(12):2298-305.
  • Moh MC, et al. (2005) Structural and functional analyses of a novel ig-like cell adhesion molecule, hepaCAM, in the human breast carcinoma MCF7 cells. J Biol Chem. 280(29):27366-74.
  • Chung Moh M, et al. (2005) Cloning and characterization of hepaCAM, a novel Ig-like cell adhesion molecule suppressed in human hepatocellular carcinoma. J Hepatol. 42(6):833-41.
  • Size / Price
    Каталог: RG80242-UT
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeksИнструкции по доставке
    Изображения
        Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».