Быстрый заказ

Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса HSPD1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_022229.2
    Размер кДНК:1722bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus heat shock protein 1 (chaperonin).
    Синоним гена:Hsp60,Hspd1-30p
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSPD1 qPCR primers for gene expression analysis, RP300978 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81014-ACGRBS16760
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81014-ACRRBS16760
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81014-ANGRBS16760
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81014-ANRRBS16760
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81014-CFRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81014-CHRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81014-CMRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81014-CYRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81014-NFRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81014-NHRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81014-NMRBS14710
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81014-NYRBS14710
    Крыса HSPD1/HSP60 Джин клон кДНК в вектор клонированияRG81014-URBS5130
    Крыса HSPD1/HSP60 Джин ORF экспрессии кДНК клона плазмидыRG81014-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.
  • Size / Price
    Каталог: RG81014-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».