After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat HSPA5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013083.2
Размер кДНК:1965bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus heat shock protein 5.
Синоним гена:BIP, GRP78
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81001-ACGRBS16760
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81001-ACRRBS16760
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81001-ANGRBS16760
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81001-ANRRBS16760
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81001-CFRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81001-CHRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81001-CMRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81001-CYRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81001-NFRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81001-NHRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81001-NMRBS14710
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81001-NYRBS14710
Крыса HSPA5 Джин клон кДНК в вектор клонированияRG81001-URBS5130
Крыса HSPA5 Джин ORF экспрессии кДНК клона плазмидыRG81001-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81001-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».