Быстрый заказ

Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса HSD17B2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_024391.1
    Размер кДНК:1146bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus hydroxysteroid (17-beta) dehydrogenase 2.
    Синоним гена:Hsd17b2
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSD17B2 qPCR primers for gene expression analysis, RP300987 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81023-ACGRBS15400
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81023-ACRRBS15400
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81023-ANGRBS15400
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81023-ANRRBS15400
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81023-CFRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81023-CHRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81023-CMRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81023-CYRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81023-NFRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81023-NHRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81023-NMRBS13340
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81023-NYRBS13340
    Крыса HSD17B2 Джин клон кДНК в вектор клонированияRG81023-URBS5130
    Крыса HSD17B2 Джин ORF экспрессии кДНК клона плазмидыRG81023-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81023-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».