Быстрый заказ

Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса HPX Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC091137.1
Размер кДНК:1383bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus hemopexin.
Синоним гена:Hpxn
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HPX qPCR primers for gene expression analysis, RP300989 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81025-ACGRBS15400
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81025-ACRRBS15400
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81025-CFRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81025-CHRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81025-CMRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81025-CYRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81025-NFRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81025-NHRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81025-NMRBS13340
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81025-NYRBS13340
Крыса Hemopexin Джин клон кДНК в вектор клонированияRG81025-URBS5130
Крыса Hemopexin Джин ORF экспрессии кДНК клона плазмидыRG81025-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81025-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».