After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat HMGN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001025624.2
Размер кДНК:273bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus high mobility group nucleosome binding domain 2.
Синоним гена:Hmg17
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81006-ACGRBS15400
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81006-ACRRBS15400
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81006-ANGRBS15400
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81006-ANRRBS15400
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81006-CFRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81006-CHRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81006-CMRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81006-CYRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81006-NFRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81006-NHRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81006-NMRBS13340
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81006-NYRBS13340
Крыса HMGN2 Джин клон кДНК в вектор клонированияRG81006-URBS5130
Крыса HMGN2 Джин ORF экспрессии кДНК клона плазмидыRG81006-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81006-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».