After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat HDGFRP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145785.1
Размер кДНК:609bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus hepatoma-derived growth factor, related protein 3 with N terminal His tag.
Синоним гена:Hdgfrp3
Виды:Rat
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81637-ACGRBS15400
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81637-ACRRBS15400
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81637-ANGRBS15400
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81637-ANRRBS15400
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81637-CFRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81637-CHRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81637-CMRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81637-CYRBS13340
Крыса HDGFRP3 Джин клон кДНК в вектор клонированияRG81637-GRBS5130
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81637-NFRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81637-NHRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81637-NMRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81637-NYRBS13340
Крыса HDGFRP3 Джин ORF экспрессии кДНК клона плазмидыRG81637-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81637-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».