HBB-B1 cDNA ORF Clone, Rat, C-His tag

Cat: RG80780-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All HBB-B1 Reagents

CRO Services

Product recommended


All HBB-B1 Reagents

HBB-B1 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
444 bp
Description
Full length Clone DNA of Rat hemoglobin, beta adult major chain with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HBB-B1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HBB-B1 cDNA ORF Clone in Cloning Vector, Rat RG80780-U
HBB-B1 cDNA ORF Clone, Rat, untagged RG80780-UT
HBB-B1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80780-ACGLN
HBB-B1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80780-ACG
HBB-B1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80780-ANG
HBB-B1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80780-ACR
HBB-B1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80780-ANR
HBB-B1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80780-CF
HBB-B1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80780-NF
HBB-B1 cDNA ORF Clone, Rat, N-His tag RG80780-NH
HBB-B1 cDNA ORF Clone, Rat, C-HA tag RG80780-CY
HBB-B1 cDNA ORF Clone, Rat, N-HA tag RG80780-NY
HBB-B1 cDNA ORF Clone, Rat, C-Myc tag RG80780-CM
HBB-B1 cDNA ORF Clone, Rat, N-Myc tag RG80780-NM
HBB-B1 qPCR Primer Pairs, Rat RP300744

HBB-B1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HBB-B1 cDNA ORF Clone in Cloning Vector, Mouse MG53145-G
HBB-B1 cDNA ORF Clone, Mouse, untagged MG53145-UT
HBB-B1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53145-ACGLN
HBB-B1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53145-ACG
HBB-B1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53145-ANG
HBB-B1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53145-ACR
HBB-B1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53145-ANR
HBB-B1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53145-CF
HBB-B1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53145-NF
HBB-B1 cDNA ORF Clone, Mouse, C-His tag MG53145-CH
HBB-B1 cDNA ORF Clone, Mouse, N-His tag MG53145-NH
HBB-B1 cDNA ORF Clone, Mouse, C-HA tag MG53145-CY
HBB-B1 cDNA ORF Clone, Mouse, N-HA tag MG53145-NY
HBB-B1 cDNA ORF Clone, Mouse, C-Myc tag MG53145-CM
HBB-B1 cDNA ORF Clone, Mouse, N-Myc tag MG53145-NM
info info
添加购物车成功! 添加购物车失败!