After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GZMC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_134332.2
Размер кДНК:747bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus granzyme C with N terminal Myc tag.
Синоним гена:Rnpk4, Rnpk-4
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80726-ACGRBS15400
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80726-ACRRBS15396
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80726-CFRBS13343
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80726-CHRBS13340
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80726-CMRBS13343
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80726-CYRBS13340
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80726-NFRBS13340
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80726-NHRBS13340
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80726-NMRBS13340
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80726-NYRBS13340
Крыса GZMC/granzyme C Джин клон кДНК в вектор клонированияRG80726-URBS5130
Крыса GZMC/granzyme C Джин ORF экспрессии кДНК клона плазмидыRG80726-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80726-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».