Быстрый заказ

Text Size:AAA

Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GYPC Информация о продукте «Клон cDNA»
Размер кДНК:288bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus glycophorin C (Gerbich blood group) with C terminal HA tag.
Синоним гена:GPC, MGC124900, Gypc
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80373-ACGRBS15400
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80373-ACRRBS15400
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80373-CFRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80373-CHRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80373-CMRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80373-CYRBS13340
Крыса GYPC/glycophorin C Джин клон кДНК в вектор клонированияRG80373-GRBS5130
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80373-NFRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80373-NHRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80373-NMRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80373-NYRBS13340
Крыса GYPC/glycophorin C Джин ORF экспрессии кДНК клона плазмидыRG80373-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80373-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.