Быстрый заказ

Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GP1BA Информация о продукте «Клон cDNA»
Размер кДНК:2154bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus glycoprotein Ib (platelet), alpha polypeptide with C terminal His tag.
Синоним гена:Gp1ba
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80271-ACGRBS16760
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80271-ACRRBS16760
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80271-CFRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80271-CHRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80271-CMRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80271-CYRBS14710
Крыса GP1BA Джин клон кДНК в вектор клонированияRG80271-GRBS5130
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80271-NFRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80271-NHRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80271-NMRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80271-NYRBS14710
Крыса GP1BA Джин ORF экспрессии кДНК клона плазмидыRG80271-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.