After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GOT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012571.2
Размер кДНК:1242bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
Синоним гена:cCAT, Aspat, Gaspat, cAspAT
Виды:Rat
переносчик:pCMV3-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80493-ACGRBS15400
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80493-ACRRBS15400
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80493-ANGRBS15400
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80493-ANRRBS15400
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80493-CFRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80493-CHRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80493-CMRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80493-CYRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80493-NFRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80493-NHRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80493-NMRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80493-NYRBS13340
Крыса Aspartate aminotransferase / GOT1 Джин клон кДНК в вектор клонированияRG80493-URBS5130
Крыса Aspartate aminotransferase / GOT1 Джин ORF экспрессии кДНК клона плазмидыRG80493-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

Ссылки
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Каталог: RG80493-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».