Быстрый заказ

Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса GLRX3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_032614.2
    Размер кДНК:1014bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus glutaredoxin 3 with C terminal His tag.
    Синоним гена:PICOT, Txnl2
    Виды:Rat
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81629-ACGRBS15400
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81629-ACRRBS15400
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81629-ANGRBS15400
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81629-ANRRBS15400
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81629-CFRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81629-CHRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81629-CMRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81629-CYRBS13340
    Крыса GLRX3 Джин клон кДНК в вектор клонированияRG81629-GRBS5130
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81629-NFRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81629-NHRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81629-NMRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81629-NYRBS13340
    Крыса GLRX3 Джин ORF экспрессии кДНК клона плазмидыRG81629-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81629-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».