Glutaredoxin 1 / GRX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Price:
Size:
Number:

Glutaredoxin 1 / GRX1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Rat glutaredoxin (thioltransferase) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Glutaredoxin 1 / GRX1 Background Information

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to theglutaredoxin family. Glutaredoxinsare smallredoxenzymes that useglutathioneas a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis ofdeoxyribonucleotidesby the enzymeribonucleotide reductase.
Full Name
glutaredoxin
References
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait