Быстрый заказ

Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса GLRX Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_022278.1
    Размер кДНК:324bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus glutaredoxin (thioltransferase) with C terminal Myc tag.
    Синоним гена:Grx, Glrx1
    Виды:Rat
    переносчик:pCMV3-C-Myc
    Plasmid:
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GLRX qPCR primers for gene expression analysis, RP301058 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81101-ACGRBS15400
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81101-ACRRBS15400
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81101-ANGRBS15400
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81101-ANRRBS15400
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81101-CFRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81101-CHRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81101-CMRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81101-CYRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81101-NFRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81101-NHRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81101-NMRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81101-NYRBS13340
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин клон кДНК в вектор клонированияRG81101-URBS5130
    Крыса glutaredoxin-1 / GRX1 / GLRX Джин ORF экспрессии кДНК клона плазмидыRG81101-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

    Ссылки
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Каталог: RG81101-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».