After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GGT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053840.2
Размер кДНК:1707bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus gamma-glutamyltransferase 1 with C terminal HA tag.
Синоним гена:Ggt, Ggtp, GGLUT, RATGGLUT, Ggt1
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80364-ACGRBS16760
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80364-ACRRBS16760
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80364-CFRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80364-CHRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80364-CMRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80364-CYRBS14710
Крыса GGT1 Джин клон кДНК в вектор клонированияRG80364-GRBS5130
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80364-NFRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80364-NHRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80364-NMRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80364-NYRBS14710
Крыса GGT1 Джин ORF экспрессии кДНК клона плазмидыRG80364-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.

Ссылки
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.
  • Size / Price
    Каталог: RG80364-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».