Быстрый заказ

Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GDPD2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106944.1
Размер кДНК:1617bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus glycerophosphodiester phosphodiesterase domain containing 2.
Синоним гена:RGD1560780
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81026-ACGRBS16764
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81026-ACRRBS16764
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81026-CFRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81026-CHRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81026-CMRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81026-CYRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81026-NFRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81026-NHRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81026-NMRBS14711
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81026-NYRBS14711
Крыса GDPD2 Джин клон кДНК в вектор клонированияRG81026-URBS5132
Крыса GDPD2 Джин ORF экспрессии кДНК клона плазмидыRG81026-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81026-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».