GALT cDNA ORF Clone, Rat, N-His tag

Cat: RG81288-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GALT Reagents

CRO Services

Product recommended


All GALT Reagents

GALT cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1140 bp
Description
Full length Clone DNA of Rat galactose-1-phosphate uridylyltransferase with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GALT Background Information

Full Name
galactose-1-phosphate uridylyltransferase

GALT cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GALT cDNA ORF Clone in Cloning Vector, Rat RG81288-U
GALT cDNA ORF Clone, Rat, untagged RG81288-UT
GALT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81288-ACG
GALT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81288-ACGLN
GALT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81288-ACR
GALT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81288-CF
GALT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81288-NF
GALT cDNA ORF Clone, Rat, C-His tag RG81288-CH
GALT cDNA ORF Clone, Rat, C-HA tag RG81288-CY
GALT cDNA ORF Clone, Rat, N-HA tag RG81288-NY
GALT cDNA ORF Clone, Rat, C-Myc tag RG81288-CM
GALT cDNA ORF Clone, Rat, N-Myc tag RG81288-NM
GALT qPCR Primer Pairs, Rat RP301244

GALT cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GALT cDNA ORF Clone in Cloning Vector, Human HG14112-G
GALT cDNA ORF Clone, Human, untagged HG14112-UT
GALT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14112-ACGLN
GALT cDNA ORF Clone, Human, C-GFPSpark® tag HG14112-ACG
GALT cDNA ORF Clone, Human, C-OFPSpark® tag HG14112-ACR
GALT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14112-CF
GALT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14112-NF
GALT cDNA ORF Clone, Human, C-His tag HG14112-CH
GALT cDNA ORF Clone, Human, N-His tag HG14112-NH
GALT cDNA ORF Clone, Human, C-HA tag HG14112-CY
GALT cDNA ORF Clone, Human, N-HA tag HG14112-NY
GALT cDNA ORF Clone, Human, C-Myc tag HG14112-CM
GALT cDNA ORF Clone, Human, N-Myc tag HG14112-NM
GALT qPCR Primer Pairs, Human HP102765
info info
添加购物车成功! 添加购物车失败!