After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat GABARAPL2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022706.2
Размер кДНК:354bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus GABA(A) receptor-associated protein like 2 with N terminal Myc tag.
Синоним гена:Gef2
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80724-ACGRBS15400
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80724-ACRRBS15400
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80724-CFRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80724-CHRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80724-CMRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80724-CYRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80724-NFRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80724-NHRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80724-NMRBS13340
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80724-NYRBS13340
Крыса GATE-16 / GABARAPL2 Джин клон кДНК в вектор клонированияRG80724-URBS5130
Крыса GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмидыRG80724-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

Ссылки
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Каталог: RG80724-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».