Быстрый заказ

Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat FZD4 Информация о продукте «Клон cDNA»
Размер кДНК:1617bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus frizzled homolog 4 (Drosophila) with C terminal HA tag.
Синоним гена:Fzd4
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80377-ACGRBS16760
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80377-ACRRBS16760
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80377-CFRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80377-CHRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80377-CMRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80377-CYRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин клон кДНК в вектор клонированияRG80377-GRBS5130
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80377-NFRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80377-NHRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80377-NMRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80377-NYRBS14710
Крыса Frizzled-4/FZD4/CD344 Джин ORF экспрессии кДНК клона плазмидыRG80377-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80377-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.