Быстрый заказ

Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat FTL Информация о продукте «Клон cDNA»
Размер кДНК:552bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ferritin, light polypeptide with N terminal HA tag.
Синоним гена:Ftl1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80491-ACGRBS15400
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80491-ACRRBS15400
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80491-ANGRBS15400
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80491-ANRRBS15400
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80491-CFRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80491-CHRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80491-CMRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80491-CYRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80491-NFRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80491-NHRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80491-NMRBS13340
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80491-NYRBS13340
Крыса FTL/ferritin, light polypeptide Джин клон кДНК в вектор клонированияRG80491-URBS5130
Крыса FTL/ferritin, light polypeptide Джин ORF экспрессии кДНК клона плазмидыRG80491-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Size / Price
    Каталог: RG80491-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.