After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat FCN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031348.2
Размер кДНК:1008bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ficolin (collagen/fibrinogen domain containing) 1.
Синоним гена:Fcna, MGC108660, Fcn1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80255-ACGRBS15400
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80255-ACRRBS15400
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80255-CFRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80255-CHRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80255-CMRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80255-CYRBS13340
Крыса FCN1/FCNA Джин клон кДНК в вектор клонированияRG80255-GRBS5130
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80255-NFRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80255-NHRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80255-NMRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80255-NYRBS13340
Крыса FCN1/FCNA Джин ORF экспрессии кДНК клона плазмидыRG80255-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

Ссылки
  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Size / Price
    Каталог: RG80255-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».