Fas Ligand cDNA ORF Clone, Rat, C-HA tag

Cat: RG80024-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Fas Ligand Reagents

CRO Services

Product recommended


All Fas Ligand Reagents

Fas Ligand cDNA ORF Clone, Rat, C-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Rat Fas ligand (TNF superfamily, member 6) with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Fas Ligand Background Information

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.
Full Name
Fas ligand
References
  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.
  • Fas Ligand cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Cynomolgus CG90868-G

    Fas Ligand cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Rat RG80024-M
    Fas Ligand cDNA ORF Clone, Rat, untagged RG80024-UT
    Fas Ligand cDNA ORF Clone, Rat, C-GFPSpark® tag RG80024-ACG
    Fas Ligand Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80024-ACGLN
    Fas Ligand cDNA ORF Clone, Rat, C-OFPSpark® tag RG80024-ACR
    Fas Ligand cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80024-CF
    Fas Ligand cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80024-NF
    Fas Ligand cDNA ORF Clone, Rat, C-His tag RG80024-CH
    Fas Ligand cDNA ORF Clone, Rat, N-His tag RG80024-NH
    Fas Ligand cDNA ORF Clone, Rat, N-HA tag RG80024-NY
    Fas Ligand cDNA ORF Clone, Rat, C-Myc tag RG80024-CM
    Fas Ligand cDNA ORF Clone, Rat, N-Myc tag RG80024-NM
    Fas Ligand qPCR Primer Pairs, Rat RP300023

    Fas Ligand cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Mouse MG50854-G
    Fas Ligand cDNA ORF Clone, Mouse, untagged MG50854-UT
    Fas Ligand Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50854-ACGLN
    Fas Ligand cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50854-ACG
    Fas Ligand cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50854-ACR
    Fas Ligand cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50854-CF
    Fas Ligand cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50854-NF
    Fas Ligand cDNA ORF Clone, Mouse, C-His tag MG50854-CH
    Fas Ligand cDNA ORF Clone, Mouse, N-His tag MG50854-NH
    Fas Ligand cDNA ORF Clone, Mouse, C-HA tag MG50854-CY
    Fas Ligand cDNA ORF Clone, Mouse, N-HA tag MG50854-NY
    Fas Ligand cDNA ORF Clone, Mouse, C-Myc tag MG50854-CM
    Fas Ligand cDNA ORF Clone, Mouse, N-Myc tag MG50854-NM
    Fas Ligand qPCR Primer Pairs, Mouse MP200825

    Fas Ligand cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Fas Ligand cDNA ORF Clone in Cloning Vector, Human HG13885-G
    Fas Ligand cDNA ORF Clone, Human, untagged HG13885-UT
    Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10244-ACGLN
    Fas Ligand cDNA ORF Clone, Human, C-GFPSpark® tag HG13885-ACG
    Fas Ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13885-ACGLN
    Fas Ligand cDNA ORF Clone, Human, C-OFPSpark® tag HG13885-ACR
    Fas Ligand cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13885-CF
    Fas Ligand cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13885-NF
    Fas Ligand cDNA ORF Clone, Human, C-His tag HG13885-CH
    Fas Ligand cDNA ORF Clone, Human, N-His tag HG13885-NH
    Fas Ligand cDNA ORF Clone, Human, C-HA tag HG13885-CY
    Fas Ligand cDNA ORF Clone, Human, N-HA tag HG13885-NY
    Fas Ligand cDNA ORF Clone, Human, C-Myc tag HG13885-CM
    Fas Ligand cDNA ORF Clone, Human, N-Myc tag HG13885-NM
    Fas Ligand qPCR Primer Pairs, Human HP100294
    info info
    添加购物车成功! 添加购物车失败!