After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat FAM45A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001127681.1
Размер кДНК:708bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus family with sequence similarity 45, member A.
Синоним гена:RGD1308326
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81049-ACGRBS15400
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81049-ACRRBS15400
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81049-ANGRBS15400
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81049-ANRRBS15400
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81049-CFRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81049-CHRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81049-CMRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81049-CYRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81049-NFRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81049-NHRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81049-NMRBS13340
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81049-NYRBS13340
Крыса FAM45A Джин клон кДНК в вектор клонированияRG81049-URBS5130
Крыса FAM45A Джин ORF экспрессии кДНК клона плазмидыRG81049-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81049-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».