Быстрый заказ

Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat FABP7 Информация о продукте «Клон cDNA»
Размер кДНК:399bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus fatty acid binding protein 7, brain with N terminal HA tag.
Синоним гена:Fabp7
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80474-ACGRBS15400
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80474-ACRRBS15400
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80474-ANGRBS15400
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80474-ANRRBS15400
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80474-CFRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80474-CHRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80474-CMRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80474-CYRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80474-NFRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80474-NHRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80474-NMRBS13340
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80474-NYRBS13340
Крыса BLBP/FABP7 Джин клон кДНК в вектор клонированияRG80474-URBS5130
Крыса BLBP/FABP7 Джин ORF экспрессии кДНК клона плазмидыRG80474-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP7 binds DHA with the highest affinity among all of the FABPs. FABPs may play roles in fatty acid uptake, transport, and metabolism. BLBP is expressed, during development, in radial glia by the activation of notch receptors. It was shown that reelin induces FABP7 expression in neural progenitor cells via notch-1 activation. BLBP variation is linked to weak prepulse inhibition(PPI) in mice and deficit in PPI is an endophenotypic trait observed in schizophrenia patients and their relatives.

  • Shi YE, et al. (1997) Antitumor activity of the novel human breast cancer growth inhibitor, mammary-derived growth inhibitor-related gene, MRG. Cancer Res. 57(15):3084-91.
  • Young JK, et al. (1997) Immunoreactivity for brain-fatty acid binding protein in gomori-positive astrocytes. Glia. 16(3):218-26.
  • Xu LZ, et al. (1996) Ligand specificity of brain lipid-binding protein. J Biol Chem. 271(40): 24711-9.
  • Size / Price
    Каталог: RG80474-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.