Быстрый заказ

Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat F11R Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_053796.1
Размер кДНК:903bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus F11 receptor.
Синоним гена:Jam1, F11r
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80240-ACGRBS15400
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80240-ACRRBS15400
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80240-CFRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80240-CHRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80240-CMRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80240-CYRBS13340
Крыса Junctional Adhesion Molecule A Джин клон кДНК в вектор клонированияRG80240-GRBS5130
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80240-NFRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80240-NHRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80240-NMRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80240-NYRBS13340
Крыса Junctional Adhesion Molecule A Джин ORF экспрессии кДНК клона плазмидыRG80240-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

Ссылки
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Каталог: RG80240-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».