After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ETFDH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_198742.2
Размер кДНК:1851bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus electron-transferring-flavoprotein dehydrogenase.
Синоним гена:Etfdh
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81034-ACGRBS16760
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81034-ACRRBS16760
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81034-ANGRBS16760
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81034-ANRRBS16760
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81034-CFRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81034-CHRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81034-CMRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81034-CYRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81034-NFRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81034-NHRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81034-NMRBS14710
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81034-NYRBS14710
Крыса ETFDH Джин клон кДНК в вектор клонированияRG81034-URBS5130
Крыса ETFDH Джин ORF экспрессии кДНК клона плазмидыRG81034-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81034-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».