After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ETF1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001008344.1
Размер кДНК:1314bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus eukaryotic translation termination factor 1.
Синоним гена:Etf1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80998-ACGRBS15400
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80998-ACRRBS15400
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80998-ANGRBS15400
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80998-ANRRBS15400
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80998-CFRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80998-CHRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80998-CMRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80998-CYRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80998-NFRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80998-NHRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80998-NMRBS13340
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80998-NYRBS13340
Крыса eRF1 Джин клон кДНК в вектор клонированияRG80998-URBS5130
Крыса eRF1 Джин ORF экспрессии кДНК клона плазмидыRG80998-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80998-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».