After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ESAM Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001004245.1
Размер кДНК:1185bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus endothelial cell adhesion molecule.
Синоним гена:MGC94065, Esam
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80241-ACGRBS15400
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80241-ACRRBS15400
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80241-CFRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80241-CHRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80241-CMRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80241-CYRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин клон кДНК в вектор клонированияRG80241-GRBS5130
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80241-NFRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80241-NHRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80241-NMRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80241-NYRBS13340
Крыса Endothelial Cell Adhesion Molecule Джин ORF экспрессии кДНК клона плазмидыRG80241-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.

Ссылки
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
  • Size / Price
    Каталог: RG80241-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».