After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ERLIN1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106353.1
Размер кДНК:1047bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ER lipid raft associated 1 with C terminal Flag tag.
Синоним гена:Spfh1, RGD1307058
Виды:Rat
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81136-ACGRBS15400
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81136-ACRRBS15400
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81136-CFRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81136-CHRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81136-CMRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81136-CYRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81136-NFRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81136-NHRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81136-NMRBS13340
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81136-NYRBS13340
Крыса ERLIN1 Джин клон кДНК в вектор клонированияRG81136-URBS5130
Крыса ERLIN1 Джин ORF экспрессии кДНК клона плазмидыRG81136-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81136-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».