Быстрый заказ

Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat EPCAM Информация о продукте «Клон cDNA»
Размер кДНК:948bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus epithelial cell adhesion molecule with C terminal His tag.
Синоним гена:Egp314, Tacstd1, Epcam
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80306-ACGRBS15400
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80306-ACRRBS15400
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80306-CFRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80306-CHRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80306-CMRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80306-CYRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин клон кДНК в вектор клонированияRG80306-GRBS5130
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80306-NFRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80306-NHRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80306-NMRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80306-NYRBS13340
Крыса EpCAM/TROP-1/TACSTD1 Джин ORF экспрессии кДНК клона плазмидыRG80306-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Epithelial Cell Adhesion Molecule (EpCAM), also known as GA733-2 antigen, is a type â… transmembrane glycoprotein composed of an extracellular domain with two EGF-Like repeats and a cystenin-rich region, a transmembrane domain and a cytoplasmic domain. It modulates cell adhesion and proliferation. Its overexpression has been detected in many epithelial tumours and has been associated with high stage, high grade and a worse survival in some tumour types. EpCAM has been shown to function as a calcium-independent homophilic cell adhesion molecule that does not exhibit any obvious relationship to the four known cell adhesion molecule superfamilies. However, recent insights have revealed that EpCAM participates in not only cell adhesion, but also in proliferation, migration and differentiation of cells. In addition, recent study revealed that EpCAM is the Wnt-beta-catenin signaling target gene and may be used to facilitate prognosis. It has oncogenic potential and is activated by release of its intracellular domain, which can signal into the cell nucleus by engagement of elements of the wnt pathway.

  • Brunner A, et al. (2008) EpCAM is predominantly expressed in high grade and advanced stage urothelial carcinoma of the bladder. J Clin Pathol. 61(3):307-10.
  • Trzpis M, et al. (2008) EpCAM in morphogenesis. Front Biosci. 13: 5050-5.
  • Munz M, et al. (2009) The emerging role of EpCAM in cancer and stem cell signaling. Cancer Res. 69(14): 5627-9.
  • Carpenter G, et al. (2009) EpCAM: another surface-to-nucleus missile. Cancer Cell. 15(3): 165-6.
  • Size / Price
    Каталог: RG80306-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.