After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat EPB4.1L5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001012023.1
Размер кДНК:1515bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus erythrocyte membrane protein band 4.1 like 5 with C terminal Myc tag.
Синоним гена:Epb41l5
Виды:Rat
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81130-ACGRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81130-ACRRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81130-ANGRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81130-ANRRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81130-CFRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81130-CHRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81130-CMRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81130-CYRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81130-NFRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81130-NHRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81130-NMRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81130-NYRBS14710
Крыса EPB4.1L5 Джин клон кДНК в вектор клонированияRG81130-URBS5130
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмидыRG81130-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81130-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».