Быстрый заказ

Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat EPB4.1L5 Информация о продукте «Клон cDNA»
Размер кДНК:1515bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus erythrocyte membrane protein band 4.1 like 5 with C terminal Flag tag.
Синоним гена:Epb41l5
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81130-ACGRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81130-ACRRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81130-ANGRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81130-ANRRBS16760
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81130-CFRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81130-CHRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81130-CMRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81130-CYRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81130-NFRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81130-NHRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81130-NMRBS14710
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81130-NYRBS14710
Крыса EPB4.1L5 Джин клон кДНК в вектор клонированияRG81130-URBS5130
Крыса EPB4.1L5 Джин ORF экспрессии кДНК клона плазмидыRG81130-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81130-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.