COX4NB cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80825-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All COX4NB Reagents

CRO Services

Product recommended


All COX4NB Reagents

COX4NB cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Rat ER membrane protein complex subunit 8 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX4NB Background Information

Full Name
ER membrane protein complex subunit 8

COX4NB cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Rat RG80825-G
COX4NB cDNA ORF Clone, Rat, untagged RG80825-UT
COX4NB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80825-ACG
COX4NB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80825-ACGLN
COX4NB cDNA ORF Clone, Rat, N-GFPSpark® tag RG80825-ANG
COX4NB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80825-ACR
COX4NB cDNA ORF Clone, Rat, N-OFPSpark® tag RG80825-ANR
COX4NB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80825-NF
COX4NB cDNA ORF Clone, Rat, C-His tag RG80825-CH
COX4NB cDNA ORF Clone, Rat, N-His tag RG80825-NH
COX4NB cDNA ORF Clone, Rat, C-HA tag RG80825-CY
COX4NB cDNA ORF Clone, Rat, N-HA tag RG80825-NY
COX4NB cDNA ORF Clone, Rat, C-Myc tag RG80825-CM
COX4NB cDNA ORF Clone, Rat, N-Myc tag RG80825-NM
COX4NB qPCR Primer Pairs, Rat RP300789

COX4NB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Mouse MG53657-U
COX4NB cDNA ORF Clone, Mouse, untagged MG53657-UT
COX4NB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53657-ACG
COX4NB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53657-ACGLN
COX4NB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53657-ANG
COX4NB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53657-ACR
COX4NB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53657-ANR
COX4NB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53657-CF
COX4NB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53657-NF
COX4NB cDNA ORF Clone, Mouse, C-His tag MG53657-CH
COX4NB cDNA ORF Clone, Mouse, N-His tag MG53657-NH
COX4NB cDNA ORF Clone, Mouse, C-HA tag MG53657-CY
COX4NB cDNA ORF Clone, Mouse, N-HA tag MG53657-NY
COX4NB cDNA ORF Clone, Mouse, C-Myc tag MG53657-CM
COX4NB cDNA ORF Clone, Mouse, N-Myc tag MG53657-NM

COX4NB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX4NB cDNA ORF Clone in Cloning Vector, Human HG14675-G
COX4NB cDNA ORF Clone, Human, untagged HG14675-UT
COX4NB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14675-ACGLN
COX4NB cDNA ORF Clone, Human, C-GFPSpark® tag HG14675-ACG
COX4NB cDNA ORF Clone, Human, N-GFPSpark® tag HG14675-ANG
COX4NB cDNA ORF Clone, Human, C-OFPSpark® tag HG14675-ACR
COX4NB cDNA ORF Clone, Human, N-OFPSpark® tag HG14675-ANR
COX4NB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14675-CF
COX4NB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14675-NF
COX4NB cDNA ORF Clone, Human, C-His tag HG14675-CH
COX4NB cDNA ORF Clone, Human, N-His tag HG14675-NH
COX4NB cDNA ORF Clone, Human, C-HA tag HG14675-CY
COX4NB cDNA ORF Clone, Human, N-HA tag HG14675-NY
COX4NB cDNA ORF Clone, Human, C-Myc tag HG14675-CM
COX4NB cDNA ORF Clone, Human, N-Myc tag HG14675-NM
COX4NB qPCR Primer Pairs, Human HP103309
info info
添加购物车成功! 添加购物车失败!