Быстрый заказ

Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat EIF5A Информация о продукте «Клон cDNA»
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus eukaryotic translation initiation factor 5A with N terminal HA tag.
Синоним гена:Eif5a
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80501-ACGRBS15400
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80501-ACRRBS15400
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80501-ANGRBS15400
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80501-ANRRBS15400
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80501-CFRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80501-CHRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80501-CMRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80501-CYRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80501-NFRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80501-NHRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80501-NMRBS13340
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80501-NYRBS13340
Крыса EIF5A Джин клон кДНК в вектор клонированияRG80501-URBS5130
Крыса EIF5A Джин ORF экспрессии кДНК клона плазмидыRG80501-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

  • Jenkins ZA. et al., 2001, Genomics. 71 (1): 101-9.
  • Guan XY. et al., 2001, Cancer Res. 61 (9): 3806-9.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Clement PM. et al., 2003, Eur J Biochem. 270 (21): 4254-63.
  • Size / Price
    Каталог: RG80501-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.