eIF4E cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

eIF4E cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
654 bp
Description
Full length Clone DNA of Rat eukaryotic translation initiation factor 4E with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

eIF4E Background Information

The eukaryotic translation initiation factor 4E (eIF4E), is a limiting component of the eIF4F complex which is a critical determinant for the translation of mRNAs. We had shown that eIF4E availability and phosphorylation promote metastasis in mouse models of breast cancer by selectively augmenting the translation of mRNAs involved in invasion and metastasis. eIF4E phosphorylation is required for the chronic action of antidepressants, such as fluoxetine in mice. Elevated levels of eukaryotic initiation factor 4E (eIF4E) are implicated in neoplasia, with cumulative evidence pointing to its role in the etiopathogenesis of hematological diseases. eIF4E is a key focus in cancer research due to its role in controlling the translation of tumour-associated proteins, that drive an aggressive migratory phenotype.
Full Name
eukaryotic translation initiation factor 4E
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait